1.
Isolation Of Local Strain Of Toxoplasma Gondii Through In-Vivo Cultivation In Mice
by Rahim Gul | Dr. Muhammad Imran Rashid | Dr. Aneela | Dr. Nisar Ahmad.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Toxoplasma gondii is an obligate apicomplexan, intracellular, parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat faeces or through the consumption of meat containing Toxoplasma gondii cysts. Thus, food animals can be the source of transmission of Toxoplasmosis in human population especially among people who consume undercooked meat in the forms of barbecues, beef steaks, kebabs, burgers and shawarmas. Oocysts of T. gondii from cat faeces were identified by using direct microscopy and flotation technique. The positive oocysts were confirmed by micrometry having diameter of 9-13 ìm. The oocysts were then sporulated in aerated condition. After sporulation oocyst were inoculated in Swiss albino mice for in-vivo culturing. After 56-70 days brain tissue was collected from infected mice and subjected to DNA extraction and PCR amplification. Similarly DNA was also extracted from sporulated oocyst for copro-PCR. Out of 200 faecal samples only three were found positive for Toxoplasma gondii through direct microscopic examination and flotation technique. From positive faecal sample and brain tissue DNA was extracted by QIAGEN mini stool kit and QIAGEN DNA mini kit. After DNA extraction the samples were examined through PCR by using specific Toxoplasma gondii B1 gene primer having 529 bp size. Two hundred faecal samples were examined for T. gondii using direct microscopy, flotation technique, bioassay and polymerase chain reaction. Out of 200 samples 3 (1.5%) were found infected through direct microscopy and flotation technique. Toxoplasmosis was more prevalent in adult cats (1.65%) as compared to young ones. Prevalence was also found high in females (2.08%) as compared to males. Similarly healthy cats have higher prevalence rate (1.30%) as compared to diseased ones. A further confirmation was done through polymerase chain reaction and brain tissue cyst Bioassay give 1 positive amplification while Copro-PCR gives 2 positive amplifications. Therefore it can be concluded that the copro-PCR is can be used for the confirmation of Toxoplasma oocysts from cat faeces and tissue cysts from bioassay in mice. Therefore, we propose that the copro-PCR can be used as the new gold standard for determining potential cat infectivity and tissue cysts from bioassayed mice or contaminated meat samples of livestock.
Availability: Items available for loan: UVAS Library [Call number: 1778,T] (1).
2.
Phylogenetic Analysis Of Haemoproteus In Chicken And Sparrows
by Anha fatima | Dr. Muhammad imran rashid | Dr. Azhar maqbool | Dr. Wasim.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2038,T] (1).
3.
Development Of Molecular Tools For The Diagnosis Of Plasmodium Vivax Using Cytochrome C Oxidase Gene
by Ayaz Shaukat | Prof. Dr. Azhar Maqbool | Dr. Muhammad | Dr. Muhammad Imran Rashid.
Material type: ; Format:
print
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2153,T] (1).
4.
Incidence Of Canine Trypanosomiasis And Standardization Of PCR For Its Diagnosis
by Sajid Bashir Khan Qaisrani (2006-VA-60) | Dr. Muhammad Haroon Akbar | Dr. Muhammad Imran Rashid | Dr.Wasim Shahzad | Faculty of Veterinary Sciences.
Material type: ; Literary form:
not fiction
Publisher: 2014Dissertation note: Thesis Submitted With Blank CD. Availability: Items available for loan: UVAS Library [Call number: 2198,T] (1).
5.
Isolation Of Surface Antigen 1 Gene Of Toxoplasma Gondii And Its Cloning In The Expression Plasmid
by Farooq Riaz (2008-VA-231) | Dr. Muhammad Imran Rashid | Prof. Dr. Kamran Ashraf | Dr. Jawad Nazir.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Toxoplasma gondii is an obligate intracellular protozoan parasite which comes under the classification of phylum Apicomplexa, subclass Coccidiasina (Cornelissen et al. 1984). Toxoplasmosis is one of the more common parasitic zoonoses world-wide caused by Toxoplasma gondii which is a facultatively heteroxenous, polyxenous protozoon that has developed several potential routes of transmission within and between different host species (Tenter et al. 2000). It is the most important source of toxoplasmosis in humans and animals, with cat as definite host and warm-blooded animals as intermediate host (Frenkel et al. 1970). It was first described by Nicolle, Manceaux and Splendore in 1908 from rodents Ctenodactylus gondii (Black and Boothroyd 2000).
Toxoplasmosis is a worldwide parasitic disease and it is estimated that about one-third total population of the world is seropositive for Toxoplasma gondii (Tenter et al. 2000). Prevalence of infection varies between countries, geographical areas and ethnic groups living within a specific region. In Humans, infection rates range from 50% to 83% in Brazil (Tenter et al. 2000; Dubey et al. 2012). Seropositivity of Toxoplasma gondii in China is about 8% with continuously increase while in USA its 10-15%, 50-70% in France and 20% in UK (Dubey and Jones 2008; Zhou et al. 2008; Jones et al. 2009). Prevalence of toxoplasmosis is higher in males (79%) as compared to females (63.4%) and the age dependent sero-prevalence reaches >92% in age group of 40 to 50 (Coêlho et al. 2003).
Transmission occurs through the ingestion of contaminated vegetable /water with oocysts, as well as the ingestion of contaminated raw/undercooked meat with tissue cysts (Gajadhar et al. 2006). Transmission may also occurs by ingestion of sporulated oocysts, or bradyzoites within cysts present in the tissues of numerous food animals (Esteban-Redondo et al. 1999). In humans, transmission of Toxoplasma gondii happens mainly by eating raw or undercooked contaminated meat, raw cow’s milk and birds eggs, swallowing oocysts dis-charged in feces of infected cats, inoculation of trophozoites through the skin, or by inhalation (Wallace 1971; Wallace 1973; Bannister 1982).
In humans, mostly infections (congenitally or post-natally acquired) are asymptomatic. Congenital infection occurs only when a woman becomes infected during pregnancy. Congenital infections acquired during the first trimester are more severe than those acquired in the second and third trimester (Desmonts and Couvreur 1974). The main clinical signs associated with toxoplasmosis are anorexia, weight loss, lethargy, dyspnea, ocular signs, pyrexia, vomiting and diarrhea, jaundice, myositis, encephalitis and abortion. Humans become infected when they ingest the toxoplasma at infective stages (oocysts and tissue cysts) found in some cat feces and in raw meats.
In addition to being hazardous to livestock animals, the T. gondii infection is also important due to its zoonotic implications (Jittapalapong et al. 2005). Congenital abnormalities in humans, such as microcephaly, hydrocephaly, chorioretinitis, convulsion, cerebral calcification, epilepsy, blindness, deafness, and mental retardation may occur if the mother acquires infection during pregnancy (Jones et al. 2003). In addition to congenital anomalies, T. gondii also causes severe neuropathologic infections in immuno-compromised hosts, such as AIDS and cancer patients receiving chemotherapy (Del Valle and Piña-Oviedo 2005).
Seroprevalence studies of T. gondii among domestic animals in South-Western Pakistan has indicated considerable prevalence (25% in cattle, 2.5% sheep) (Zaki 1995) and suggesting potential transmission to the human community. Small scale study in urban area of Rahim Yar Khan (Punjab), Pakistan has revealed that the overall prevalence of toxoplasmosis in food animals is 19% (Ramzan et al. 2009). Another study has already been published that untreated patients with leprosy in Pakistan have shown significant seroprevalence (29.6%) of antibodies against T. gondii (Hussain et al. 1992).
Vaccine against toxoplasmosis is not available yet with one exception (“Toxovax” for sheep). Vaccine against T. gondii in animals used for human consumption may block the possible transmission to humans (Bhopale 2003). SAG1, among one of the major antigenic components of Toxoplasma gondii is a major surface antigen identified on the surface membrane of this parasite using a monoclonal antibody (Handman et al. 1980). SAG1 is an important surface antigen, expressed by tachyzoite form of T. gondii and is a putative candidate for vaccine and diagnostic against toxoplasmosis (Sharma et al. 1983; Godard et al. 1990). Immunization with SAG1 adjuvanted with saponin Quil A or incorporated in lysosomes provided total protection after challenge (Bülow and Boothroyd 1991; Khan et al. 1991). SAG1 is single copy gene with no introns (Burg et al. 1988), regulates both humoral as well as cellular Th1 immune responses (Liu et al. 2008) and is powerful candidate for vaccine against toxoplasmosis. SAG1 is a potent candidate of diagnostics for detection of serum antibodies against toxoplasmosis in Man and animals (Abu-Zeid 2002).
Availability: Items available for loan: UVAS Library [Call number: 2258-T] (1).
6.
Molecular Diagnosis Of Anaplasmosis In Buffaloes
by Muhammad Salman (2008-VA-135) | Prof. Dr. Khalid Saeed | Dr. Muhammad Imran Rashid | Dr. Wasim Shehzad.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Bovine Anaplasmosis is a tick-borne haemo-rickettsail disease, caused by Anaplasma species transmitted mechanically by flies, biologically by ticks and blood contaminant fomites. It is an economically important tick-borne disease of buffalo in tropical and sub-tropical areas of the world. In current study, we developed and optimized PCR first for detecting Anaplasma at genus level in buffaloes. One hundred (100) blood samples were collected from buffaloes around the Lahore region. The stained thin blood films were examined microscopically and 37% blood samples were found positive for intra-erythrocytic bodies which were then selected for DNA extraction. The DNA was extracted using commercially available kit for eventual use in optimization of PCR for diagnosis of bovine Anaplasmosis. The primers were designed targeting 16S rRNA gene of Anaplasma. For the detection, the PCR product was run in 2% agarose gel stained with ethidium bromide and thirty seven samples showed the amplification band at 179bp. The selected samples were sent for ABI sequencing to Singapore for the accurate detection of the Anaplasma species. The sequencing results were blasted with database of Genbank and we observed homology with Anaplasma phagocytophilum. We found 37% prevalence of Anaplasmosis in buffaloes through PCR. However more studies are required to confirm the species of Anaplasma infecting buffaloes (Bobalus bobalis) by designing species specific primers. Furthermore, additional studies are needed to establish the epidemiology of Anaplasmosis by using molecular tools in different geographical areas of the country for their better control.
Availability: Items available for loan: UVAS Library [Call number: 2389-T] (1).
7.
Indigenous Elisa Kit For Toxoplasma Gondii: Optimization Of Antibody Detection Elisa Of Sag 1 Protein As An Antigen In Mouse Model
by Madiha Sana (2013-VA-957) | Dr. Muhammad Imran Rashid | Dr. Haroon Akbar | Dr. Wasim Shehzad.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Toxoplasma is an apicomplexan intracellular parasite which is the cause of toxoplasmosis
in man and animals. It occurs by the ingestion of oocyst from feces of cats or by eating raw meat
in which cysts are present. It is the one of the major cause of encephalitis and abortion in
immuno-compromised animals and humans. As it is difficult to screen out infected live animals
from field, it is important to vaccine animals as well as humans for toxoplasma to prevent its
transmission from animals to humans and from humans to their off springs. Cloning of surface
antigen genes plays an important role in development of vaccine and for serology of T. gondii.
Enzyme linked immuno-sorbant assay proves to be a significant tool to estimate the humoral
response elicited against expressed recombinant protein in mice.
The recombinant protein of SAG1 was collected from Molecular Parasitology
Laboratory, University of Veterinary and Animal Sciences, Lahore. In the previous studies,
SAG1 sequence was cloned in the expression plasmid and successfully expressed in prokaryotic
expression system. In the current study, rSAG1 was quantified by using BCA protein assay
through BioWORLD protein quantification kit. In another experiment, the Swiss mice were
immunized with 15 μg rSAG1 protein 3 times with 2 weeks intervals. Two groups of mice were
formed with five mice in each group. Sera were collected after 2 weeks of each inoculation. For
performing ELISA, four different experiments were performed with different concentrations i.e.
5μg/ml, 250μg/ml and 500μg/ml with two different dilutions; 1/50 and 1/20. The O.D. values of
concentrations 5μg/ml and 250 μg/ml with two dilution series of 1/20 and1/50 were not observed
significant while the antigen coating concentration of 500 μg/ml with 1/50 dilution showed 1:160
titre and with 1/20 dilution showed 1: 1280 titre after the 3rd shot. The O.D values with 500
CHAPTER 6
SUMMARY
SUMMARY
36
μg/ml concentration with 1/20 dilution after the 3rd shot were observed significant in the
inoculated group as compared to the O.D values of un-inoculated negative group. It is suggested
to carry out ELISA with purified rSAG-1 protein and to optimize ELISA to test toxoplasma
infected mice. Availability: Items available for loan: UVAS Library [Call number: 2433-T] (1).
8.
Occurrence And Economic Losses From Theileriosis On Commercial Dairy Farm Of Holstein Friesian
by Muhammad Rashid (2014-VA-503) | Dr. Muhammad Imran Rashid | Prof. Dr. Khalid Saeed | Dr. Liaquat Ahmad.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Background: Theileriosis is a tick-borne disease and it is transmitted by the bite of ticks.
Previous work on disease problems in the study area suggested that Ticks and Tick-Borne
Diseases (TTBDs) are the major constraints to cattle production. They cause economic losses to
farmers in terms of cattle mortality, loss of body weight, loss of milk production and costs of
control of TTBDs by use of acaricides. Theileria is one of the major threat to cattle as it causes
anemia, weight loss, decrease production, mortality, treatment cost and cost for the control of
theileria. The proper data for losses atributed to theileriosis is still not available in Pakistan. For
this purpose a study was carried out in a commercial exotic dairy farm to evaluate losses
associated with theileriosis
Methodology: The study was done during the period of theileriosis to calculate its economic
effect on animal health and production. A total of 150 animals were selected randomly using
random number sample formula. The animal tag numbers were compared with random number
table, comparing animals were slecteded for study. Thin blood smear was performed for
diagnosis haemoparasite, further PCR was performed on those animals that were found +ve for
intraerythrocytic bodies. Faecal examination, California mastitis test, teat abnormality and
parturition history were recorded for the screening of these factors that decrease milk production.
After final grouping, milk production was recorded to identify the effect of theileriosis on
production. As theileriosis cause anemia due to destruction of RBC’s. body condition scoring
was also performed. Physical examination (lymph node and body temperature) of animals were
also performed to evaluate the clinical and subclinical theileriosis.
Results: For the evaluation of theileriosis, microscopy was performed on all the animals’ blood
samples. Haemoparasites were found in 28.67%. These were further processed by PCR for the
CHAPTER 6
SUMMARY
Summary
55
detection of theileriosis. Theileria was found in 27.90%. Screening of clinical and subclinical
mastitis by Califirnia Mastitis Test and microscopy for gastrointestinal parasite were performed.
On faecal examination, there found nematode, cestode and balantidium in 51.72%, 60.92% and
42.53%% respectively. After deworming with Valbazine and curafluke, nematode, cestode
(monzia), balantidium and coccidiosis were found in 0%, 39.13, 43.48% and 4.35% respectively.
Before grouping clinical and subclinical mastitis were found in 5.38% and 24.62% respectively.
After grouping clinical and subclinical mastitis were evaluated by California mastitis test with
two weeks interval. At 7th week clinical and subclinical mastitis were 3.85% and 7.69% due to
improved management. The decrease in milk production for clinical and subclinical theileriosis
was 87 lit./animal and 42.77 lit./animal. Costs for control, treatment and mortality were 0.12%,
0.20% and 13.09% respectively from overall farm expenditure. The prevalence of haemoparasite
was 28.67%, while the prevalence of theileriosis was 8%. The new cases of theileriosis were
recorded and incidence of theileriosis was found to be 2.25%. Overall losses due to theileriosis
was 13.70%.
Outcomes: We can conclude from our finding that theileriosis has drastic affect on the
profitability of the farms. Then losses can be attributed to decreased milk production and
mortality. Medications and control measure for theileriosis have added effect on the losses at
exotic animal breed dairy farms.
Perspectives: Cost analysis studies need to be done on different dairy farms of cattle of different
breeds at different ecological/climatic zones of Pakistan so that investors would know the risks
of establishing dairy farms. Availability: Items available for loan: UVAS Library [Call number: 2515-T] (1).
9.
Exploring Anthelmintic Resistance In Ovine Haemonchosis Through Faecal Egg Dna At Livestock Research And Development Station, Paharpur, D .I. Khan
by Ghulam Hassan (2007-VA-144) | Dr. Haroon Akbar | Dr. Muhammad Imran Rashid | Dr. Muhammad Ijaz.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Gastrointestinal nematodes are recognized as a major constraint of small ruminant production system at small and large-scale farming in developing countries, leading to significant economic losses. The most important of these is Haemonchus contortus. Anthelmintic resistance now poses problems to sheep farmers throughout the world. This study has been designed to check anthelmintic resistance against haemonchosis of sheep by an in vivo method. The current study was carried out at Parasitology laboratory (Toxovacc lab), Department of Parasitology, University of Veterinary and Animal Sciences, Lahore. 100 faecal samples were collected from sheep at Livestock Research and Development Station, Paharpur, D.I. Khan. Animals were drenched with anthelmintic (Albashell containing Albendazole 2.5%, administered @10 mg/kg of body weight) orally after 1st sampling, at 0 day. The faecal samples were examined microscopically, micrometery was exploited and EPG analysis was performed by using McMaster technique. After 14 days, the second sampling was done. The fecal samples were brought and stored at 4°C in Parasitology laboratory (Toxovacc lab). Pre-trial & Post trial EPG were compared and positive samples were taken (tag#1057 Damani sheep male, tag#13 Balkhi sheep male, tag#1096 Damani female, tag#06 Balkhi female, tag#20 Balkhi) for egg isolation (Module, 2004) for egg DNA extraction through classical method of Phenol-Chloroform-Iso-Amyl Alcohol extraction. DNA samples were subjected to polymerase chain reactions (PCR) targeting β tubulin gene for detection of benzimidazole resistance at genetic level. Fecal egg count reduction percentage of 74.57% at day 14 post treatment clearly shows the presence of benzimidazole drug resistance in parasites infecting Balkhi and Damani sheep at Livestock Research and Development Station, Paharpur, D.I. Khan.
Summary
64
In conclusion, PCR-Sequencing technique finds its value in the detection of benzimedazole resistance at molecular level in eggs of Haemonchus contortus of sheep and this technique also helps the understanding of the development of drug resistance in the parasite. Availability: Items available for loan: UVAS Library [Call number: 2513-T] (1).
10.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
11.
Anthelmintic Activity Of Withania Coagulans Against Gastrointestinal Nematode Of Sheep In District Killa Saifullah, Baluchistan
by Yousaf Gul (2009-VA-145) | Dr. Muhammad Lateef | Dr. Saadullah Jan | Dr. Muhammad Imran Rashid | Dr. Wasim Shehzad.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Evaluation of anthelmintic activity of Withania coagulans was studied against GIT nematodes of sheep in district Killa Saifullah Baluchistan. Sheep of the district were screen out for the presence of GIT nematodes. Animal positive for GIT nematodes and having 150+ Egg per Gram (EPG) of feces was included in the drug trial. Animals were treated with extract(s) of locally available herbal plant (withania coagulans) and levamisole. Two types of plant formulations that is crude powder and crude methanole extract were prepared each with various dosages. The effect of both medicinal plant and levamisole was observed on different groups of animals and the results were analyzed with appropriate statistical tool. Eighty animals were randomly divided in to eight groups (10 animals in each group) i.e. A, B1, B2, B3, C1, C2, C3 and D. Animals in group A served as control untreated group. Animals in groups B1, B2 and B3 were treated with crude powder of Withania coagulans at the dose rate of 1, 2 and 3 g/kg body weight respectively. And Animals in groups C1, C2 and C3 were treated with crude methanol extract of Withania coagulans at 33.3, 66.6 and 100mg/kg equivalent dose rate of 1, 2 and 3 g/kg body weight respectively. Animals in group D were given Levamisole at the standard dose rate of 7.5 mg/ kg body weight. Data was analyzed by using SPSS version 20.0; comparative analysis was done by applying ANOVA. P value <0.05 was taken as significant. The analyzed data and the results revealed that Levamisole is still a better anthelmintic against ovine nematodes in district Killa Saifullah Balochistan. Efficacy of levamisole tested for 15 days in-vivo sheep was up to 92%. This efficacy was much higher than the various forms and dosages of medicinal plant. The efficacy of Levamisole was significantly higher (P<0.05) than all forms and dosages of medicinal plant. Group C3 treated with crude methanol extract of Withania coagulans at the dose rate of 10mg/kg equivalent to 3mg/kg showed highest efficacy of the plant that is up to 48%. The efficacy showed by the form of the medicinal plant used in group C3 against ovine GIT nematodes was significantly higher (P<0.05) than all other forms of the plant. Animals in group B1, B2, B3, C1 and C2 showed anthelmintic efficacy of 19.47%, 23.58%, 31.66%, 31.76% and 33.33% from day 0 to day 15th post-treatment. Gastrointenstinal nematodes of sheep have produced anthelmintic resistance against Levamisole at the dose rate of 7.5mg/kg. In previous studies Levamisole had showed efficacy of 99.99%, 99% and 98%. It is therefore recommended that further investigation on huge scale should be passed out concerning a great number of animals, quantities higher than those used in the present study, documentation of active principles, and calibration of dose and toxicity studies for drug development from the herbal plant.
Availability: Items available for loan: UVAS Library [Call number: 2688-T] (1).
12.
Phylogenetic Analysis And Gis Mapping Of Boophilus Species Of Ticks Of Bovine And Buffalo Of District Peshawar
by Zulfiqar Ahmad (2015-VA-11) | Dr. Muhammad Imran Rashid | Dr. Muhammad Oneeb | Dr. Mamoona Chaudhry.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: Livestock is playing a major role in the uplift of our national economy in terms of revenue from milk, meat and hides. In spite of this major contribution this sector is facing hurdles in its development. The infectious diseases and their vectors have occupied a mainstay in posing the uplift of this sector. Boophilus is an important biological vector for various protozoan and bacterial infections in animal as well as human. To date the identification of these ticks mainly rely on the morphological basis which have many variations among different identification keys. To make the identification more accurate at species level, the use of molecular tools is very necessary. Ticks were collected from the various areas of district Peshawar through random convenient sampling method. Briefly, 50 cattle and 50 buffaloes were sampled through forceps. Various ticks spp. were stored in 70% ethanol for further processing. Among the species Rhepicephalus microplus (Boophilus microplus) was the most prevalent specie (25.64103%) followed by Rhepicephalus annulatus (5.413105%) Rhipicephalus decloratus (5.128205%) Rhipicephalus distinctus (4.273504%), Rhipicephalus arnoldi (3.988604%), Rhipicephalus evertsi (5.698006%), while in Heamaphysalis species Heamaphysalis aciculifer highly prevalent (5.128205%) followed by Haemaphysalis parmata (4.843305%), Haemaphysalis excavatum (3.988604%) and Haemaphysalis houyi (3.988604%), so far Hyalomma species is concerned includes Hyalomma anatolicum (3.988604%), Hyalomma trancatum (4.843305%), Hyalomma detritium (5.982906%), Hyalomma egyptium (4.273504%), Hyalomma impeltatum (0.854701%) Hyalomma rufipes (1.709402%), Amblyomma pomposum (4.273504%), Dermacentor rhinocerinus (2.849003%), D. circumguttatus (3.703704%), and
Summary
44
Dermacentor marginatus (2.564103%) are highly prevalent in cattle. Among the buffalo, Rhipicephalus 173 (43.25 %) followed by Haemaphysalis 82 (20.5 %), Hyalomma 54 (13.5 %), Dermacentor 26 (6.5 %) and Amblyomma 9 (2.25 %). The species prevalent in Rhipicephalus are Rhipicephalus microplus 74 (42.78%), Rhipicephalus annulatus 15 (8.68%), Rhipicephalus decloratus 19 (10.99%), Rhipicephalus distinctus 14 (8.10%), Rhipicephalus arnoldi 16 (9.25%), Rhipicephalus evertsi 17 (9.84%) and Rhipicephalus kochi 18 (10.40%) followed by Haemaphysalis aciculifer 18 (21.96%), Haemaphysalis parmata 15 (18.30%), Haemaphysalis excavatum 23 (28.05%), and Haemaphysalis houyi 26 (31.70%), so far Hyalomma species is concerned, Hyalomma anatolicum 10 (18.52%), Hyalomma tranctum 7 (12.96%), Hyalomma detritium 9 (16.67%), Hyalomma egyptium 7 (12.96%), Hyalomma impeltatum 10 (18.52%), and Hyalomma rufipes 11 (20.37%) and Dermacentor rhinocerinus 9 (34.62%), followed by Dermacentor circumgutattus 8 (30.76%) and Dermacentor marginatus 9 (34.62%) and Amblyomma is concerned Amblyomma pomposum 9 (2.25%). DNA was extracted from the Rhipicephalus (Boophilus) ticks through phenol-chloroform method. The extracted product was then run by gel stained ethidium bromide. The gel was visualized and examined bands on UV illuminator. Different sequences were retrived from database and genus specific primer were designed for the amplification of ITS-2 gene of Rhipicephalus genus of hard ticks. A consensus sequence was retrieved, a set of primers were designed by using Bioedit softwere version 7.2.6. DNA was extracted from 100 ticks and then run by PCR. Specific primers were designed for ITS2 gene. Phylogenetic tree based on the DNA sequences amplified from extracted from all the comparison with ticks and determined Genus Rhipicephalus area that are ITS2 Rhipicephalus ITS2 ribosomal RNA gene sequence 18s, thus obtained from Genebank. Availability: Items available for loan: UVAS Library [Call number: 2848-T] (1).
13.
Larvicidal And Adulticidal Effect Of Natural Herbs Against Mosquito Population
by Anam Shahwar (2015-VA-1347) | Dr. Nisar Ahmad | Dr. Muhammad Imran Rashid | Dr. Uzma Farid Durrani .
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: Mosquitoes serve as vectors for a wide assortment of human and veterinary pathogens and cause pervasion of numerous infection. Many processes fall for the control of mosquito but the cross resistance didn’t let them successful. Plants are viewed as the natural industry of such chemicals which have promising medicinal and pesticidal properties. Ocimum basilicum regularly known as Basal and Calotropis procera which is famous as apple of Sodom has shown the insecticidal activities against mosquito. Ocimum basilicum and Calotropis procera has adulticidal and larvicidal activity against laboratory reared mosquito population. For the study plants of Calotropis procera and Ocimum basilicum has collected from Lahore city. Leaves stem and flower of Ocimum basilicum and leaves of Calotrops procera had ground after drying for their soxhelet extraction. Their methanol and aequeous extract was used against laboratory reared mosquito to check their efficacy. Serial dilutions of each plant was given to third and fourth instar larvae and three day old adult. Third and fourth instar larvae has shown complete mortality within one hour in 700ppm and 650 ppm of methanol extract of both plant whereas in water extract the concenteration were 450ppm and 500ppm. Mortality of larvae and adult mosquito has been recorded after every ten minutes for one hour and then after 24 hours. The lethal dose concentration from dose-probit model is 700ppm of and 650ppm (methanol extraction) and 450ppm and 500ppm (water extraction) of Ocimum basilicum and Calotropis procera. according The current study has checked the efficacy of indigenous plant extracts against mosquito for eco-friendly approach to control mosquito. Availability: Items available for loan: UVAS Library [Call number: 2949-T] (1).
